Japanese | English    

BAC Detail View

DME1-020G18.F
Clone Detail
Accession no AG933461
Direction 5'
Sequence AGCAGGCGGTTGGTTTAGCTGCATTACCCTCCATTGACCTGTGTTCTTCCTACGAGATTA
TCCTTCTGGGAAGTGGATCCCCTCACCAAGGTGGCTATCAAAGCTGTCTGCACGCACAGC
GTCCACTTTCTAGCTGTTCGATGTAGCATATTTAACCGACTGACTTAAGACTACGTGGCT
GAGTGTTTTTGTCCGTCGTTGGGAGTGTTGTGTCCCAACAGGTGGTTGCTATCTATAGCG
GCAGGTTCGTAAGAAGTTTAAAGATTGGTCATCCGGCTGCGCAACTATTTTGCGGCACAC
TCCGGCTTGTACTTAAGACCCTTTGGCGAGTCTATTAAATTATCATTTTGGCCAGTTTTT
ACGGCCGACTTGTAAGGCACAAAATAACAAAAATGGGCGTCGCAAAGGGGGTCAAAATGC
TAACGAAAATAACACTGTCTATAGGTAACGCTCGTTGTGGGTGTCTATTTGTTT
Homology
Chromosome 3L
From 20468162
To 20468635
Strand -
E-value 0.0

DME1-020G18.R
Clone Detail
Accession no AG933462
Direction 3'
Sequence TCGCTTCTTGAGCATTTGCCGCGCCAAAATGGGTAGCTTTGACGCATTGGTAGCCTCCAG
GCGGGTGTTAACTCGCCCCGCGATGTCCGTGGCCTGCTGCTTGGTCACGTTGCCAAAAAT
AAACTCTCTGTGTGCAGGCGCTGGAAGAACTCCTTAGCGAAGTTCAACACTCTATCGTAC
GTGACAACTANGAATGATTATAAGATAATTAGTAATCTTCTTTTTTAGATATTCCAAGCT
AACATCTTACGTTCCATAGCGTCCAAGAGCTCCATATTGGCCCACGCATTTTCAGTTAAC
AACAGAGCTAAATAGTATATGGAATGCTGATATGGTTGCTCAGCCTTAAAGTTTTTCAGT
GAACGTACGTATTCCTCCTTAAGGATGTCAAAACGTTTCTCGTCGATGGAGAAGTCAAAA
AGGTGATCTAACAGCTTCTCCAACAGCACCACCTGTTTGTCACTGAAGCCCCGAATGGTG
AACTGCAAGAGAGAAAACATTTTGTAATTTGAAAGTTCAATGAA
Homology
Chromosome 3L
From 20365818
To 20366342
Strand +
E-value 0.0