Japanese | English    

BAC Detail View

DME1-020A19.F
Clone Detail
Accession no AG933251
Direction 5'
Sequence ATCGATCCCATTTAAATAGTTTTTATTGAAATTCTTCGCACTTAATTGAGCTGTGCGTTC
CTTTGAGCAACCATTTAATCAATATTTAATAAGGGCTATTATTTATGAAGAGGTGAAAAT
TCGAATTTTAAATTGATGCATGAAACTTCAATATGACATTCATATTAATGTAATTGCGTA
ATTATTAATATTCGATCGTTGTACTTCCAAATACTTAAATGGCTTTAATTTTCATTTAAA
CGAGCTTATTCAGATTGAGCACATTTTACAAATTATTCTCAAAAACTCGATATAACTTAA
ATTCCCAAATAATTTGTTGAGTACAAACACAAAAGCTTTTCCTTAAATTTATATCAAATA
TATAAATAAAACGATCAATTTAACCTGTGTGATATTTATTTGACGGAAAAAACTATCCAG
AGATTCATACTAAAAATGAGATCTTGTCCGACCCCGAACACGACATTGCCTGACCTTTGG
TCTGCCCCCTCT
Homology
Chromosome 3L
From 7850214
To 7850706
Strand +
E-value 0.0

DME1-020A19.R
Clone Detail
Accession no AG933252
Direction 3'
Sequence TAGTATGAAAGCAATTCATTGTTCCAGCTTTTTTTTTTTTAGCTTTTTTTATTGCAAGTT
AGCAACTGGTAGACCAGCCGCCACTAAAGACTGCTGTGTGAAGCCAATCTGAACGTCAAC
GACTTCATTCCGCGGGCTCCACTTTCAGTTGGCCAATTGGTAGTTGGTGTATCGAGGGAT
ATACTTGAGCCTCTTCTTGTGTTTCTTCTAGCCTCCCATAGTTTCCACTAGCCCCGCCAC
GCTTTGTGTATTTCACTGGGCTCCTCCACTTGTGGCTCGTCTTCGGACTTCCACTTCCTT
GTGCCTAAACCATCGGGGCCCCCTTGTGTGCCAGTTTTTAACTGGCTTCCCTGCGGACGA
CCAACGACGACCACTCCCCCACCG
Homology
Chromosome 3L
From 7975320
To 7975654
Strand -
E-value e-150