Japanese | English    

BAC Detail View

DME1-020A14.F
Clone Detail
Accession no AG933247
Direction 5'
Sequence GAGCTCTCTAAGTCCCCGTGGATCCAGCGCAACGAAGTTATACTCATACAGTATGGTATG
TGGTCCATGCAAATGCGAAGGCTTAGGACAGGCATACAGTTCGCTATGCATCATTAATAG
TTCTGACATCTCCGTTCAGAGTGAAATGTTGACTTGGCACATTTCGGAGGTGACTCCAGT
TAATTTTCCTATGAGATGTCACCAAATCGCCTTTAACACGTTTTCATTTTTTTCCCCATT
TTGTGTTTAAGGAACATGACAAGAAAGCTGAATGTCCAGCTTTTAGTGTGACCACTCTTC
TCTAAAACTCACAATGTGCCCTTGCCTAACTATATTAAAAGTGCACTTTTAATTGAAATT
AGTTTATGCTTCATTTAAGAAACTTGAAGCAGGAAGTTTCCACCGCAGCAACAGACAAGT
GTTTTGGCTTAAGCTGAAAAGTGTGCAAAATCACATTTAATTTACGATGACACCCGAAAA
AGTTTTAAAGTGTTGTCTCAACGAGTAACATTGATAGTTGAAGATGCACATAAAGCCACT
CCGAGACAAAAGTGCGCAAAATGTGCCATCGGATTGGGCTCAGCAGGTGATCCGCCTCCA
CTTCGATTTC
Homology
Chromosome X
From 4391434
To 4392043
Strand +
E-value 0.0

DME1-020A14.R
Clone Detail
Accession no AG933248
Direction 3'
Sequence ATGCCCCCTTTTCAAGCCAAAGCCACTAAGGTTTTTATGCCCTTGGTAGTAAACCAGACA
CTGAATTTTCGGCCGCCTATTGCATTCCGCTTGGCTGGGAAAAGTCTTCACGGTATGTCA
AGTATTAATTTTGCAGTTTGTTTTTTTTTATCACAGTTGAGATTAAATTTAATCGGAAAT
ATTGCCACGGCCTCAGGCTATGCGGCGGCAATATTTGAAATGAGAAAAATGGGAATACAG
TTGAGCATTAAAGTAATCATTGAAATACTAGAACAATTTGAAAGCCATTGAGTATTTAAA
TTCATTAAATGCATATTTCCAACTCTTTAAAGTATATTATACATTTATTTAATTCACATG
AAATTCTAGTTTGTTCTAAAATGTATATAAATTGCAGGTAACTAAATATATTTATAAATT
ATAAAACTGATTCCATTTCTGTTTTTTTGTTTTGGCTCAGTTATAGCTGGCTTATCATTG
CCAATTTTCTGTTTGGTCATTTTCATTGTGACCATTTTCGCACACGTATTTTTCCGGCCT
TCGCTTGGGGTCGAACCAAAATGGCCGACTCTGCTGCCCATCCATTTTCATTCAGCCCCA
TTCCCATTCCCATTTCCATTTC
Homology
Chromosome X
From 4400066
To 4400687
Strand -
E-value 0.0