Japanese | English    

BAC Detail View

DME1-018K10.F
Clone Detail
Accession no AG932458
Direction 5'
Sequence ATGTGACGCGGTCGCACGACATCAAACACAACGAACACGCGGCGTATGCGTCACATTAAG
TATACGCCCACGTGACACACGCTCTGTGTGCTGGCCCCGATTTCTCTCTCGAGCACCAGG
CTCGGCTGTTATTTAAACACAACAATTAAAACGGTTTTGCCAGCACACATACACACACCC
AGCATCCTTGTTGGAGCTGTTTATTTAGACGCAGGCATGTAGACATAACATTCAGTCCAA
GAACAGGAACACAAGGAGCACAAAACCCGGCTGAAGGAGAAGCAAATTGAATGAACACGC
GCCCCGAAAAGCGTTTAATAAACACAAAAGCAACAGAGGCAGAAACAGAACTGAAACTGA
AACAGAAACTGAAGTTTAGGCCCGAGAGCGAATCTTGACTGTGTCTGCGACCCTCTTTTT
TGGCCCGGCTTAATGAAATGTAATGATGAGTGGGCGGCCTCGGGTCCAAGAAGGCGTGGC
AGTGGCATCTAGGCACACAGAATATGGTGGGAGAAAGTGAGAAAATGGCAG
Homology
Chromosome 2L
From 18266549
To 18267079
Strand -
E-value 0.0

DME1-018K10.R
Clone Detail
Accession no AG932459
Direction 3'
Sequence TTCCCGGTCTGGCTGTCTATCTCACTGTCTGAGTCCATAATTGAGGCGCTTACTTGGGAG
ACAGCGAGTGGGAATGAAGGTGATGGGGAGCAATCAAAGAGCGTGGAAAGTGCTGGGGAA
AACTGCAACTGGAAAAACAGCCCGGGGGCACAAGGTGCACATAGCAGATGCTCGAGTAGA
GCACCAGGAATCCGACTGAGATAAGCAGGGAAAATGAGATACGGGAGATGCGATGAGGCA
AAGCAAACACCAAGCTAGTGAAAATATGCGAACAGCGTAATGAAATTGTTGCAATAAATT
GCTTGGCAACCAAGGTAGAAATTAATTGGATAAATATTTTGGTAATGCCACAAGATCCCA
ACCCAGGCAGAGAAAGTTAATTACAAGTTCAGCTGAGTTTTCAAATGAGTTTTCCCTTTC
AGCTGAA
Homology
Chromosome 2L
From 18169482
To 18169908
Strand +
E-value 0.0