Japanese | English    

BAC Detail View

DME1-016I04.F
Clone Detail
Accession no AG931223
Direction 5'
Sequence GAGCTCCGGCAGCTCACTTAACATCCAACGCATCGGCCTGCAGCCGCCGCCAGTCGGTAC
GCCCAACTTTACGCCGCGCCACCCATCGCCCCTGCTGAACAACGGAGTTAGTGGCGTCGG
AAGCGGCAGCGCGAAAGGTAAGCAAGCGGTTTTGCCAGCGACGCTCGATGAGGATGCGTC
CATCGACGCGGAGATGGAACAGCTTGAGCTAGATTTCAGTGTTCGTGCCCACGCCCGCGC
AAACTCTATTGCCAGCGCCAGCGGAAATGCCAGCACCCTGCCGCCTCCCTCGAAACCACC
GCGCATTCCCCTGTCGCAGGTGGACGAGCAGCCGGCTG
Homology
Chromosome X
From 18533296
To 18533633
Strand -
E-value 0.0

DME1-016I04.R
Clone Detail
Accession no AG931224
Direction 3'
Sequence GGAGCTTGGACCTGGACGTGGACCTGAACCAGAACCCCGTTCTCGATGTGGACATTTGTG
ACTTTTTTCGGTTCCTCAGCTCCGGCTTTTGTTCTTTTGCGTGCTCAGCTCCACGGAATG
AAACGCAGCGAATCGAGTGGAGACGAATCGCGTCGAATCGAATCGAATCGGTCCAAAAGT
GCAAATTTCCGTCCACGATTTCCTCCCTCTTCTCATTTGTTCAGCCGACGAAGACGCCGT
CGCCTGCTCATTTATATATTTTGTTTTATTTCGTTTTGGTTTTGTTGTATTTAAATTGTT
AATGTGCTGCCCGAGGAGTCTGTCTTTGGGGAATTAGCACGGCTTTTGTTCTTCTTATTG
CAACTTGTTAAAATTCCGATCGGAGGACTGGAATGACGGGGCGGAGTTGCGATTGAAAGG
GAAGGCTATATGGCAA
Homology
Chromosome X
From 18434837
To 18435272
Strand +
E-value 0.0