Japanese | English    

BAC Detail View

DME1-014J05.F
Clone Detail
Accession no AG930090
Direction 5'
Sequence GAGCTCGAATGGGTTCGTGTTAGAAACTGCACTTGACAATTAAACTCACAGAAAAAAAAA
ACAGATGAAATCCGTGTTGTCAAATATAACAGGGATCAGGACAGGACAGGGATTTGGTGC
CAGGACCCTCGTCGAAATCCGATCCCTCGTAGCCCGAAAGTCGCGCTGTGGAGTCTCGAG
TGTTTAGGGGTTGAGCATCATTATTTACGATTCATGCTCCATTGGGACTAATGGATATCC
ATATGCAGCCGACAATTTGTGAAATATTTCAGACACCTATTTGTTAAAATCGAAAACCAA
TCTAAAGCCACATGGTGTCTGCGCTTGTTTATAATTTCGTAAAAATATATGGCTGAGGAA
GACTTTTATTTAAAGAAGCTGGAGTATTATGTTAATTTTGCCCTTTTATCATAATGTAAA
AGTGGTTTTGTGTTTGTTAAAATGAGAGAAGAGAGCGTGCCCGACTGCTTAACGATATTA
ATTTTTGCATCTACCACTCCTTCGTCATTTAAGACAGATCATCCCAAAATTCTA
Homology
Chromosome 3L
From 14956939
To 14957473
Strand -
E-value 0.0

DME1-014J05.R
Clone Detail
Accession no AG930091
Direction 3'
Sequence ACACTTACACAAACAAAAACACAGACGATGACAAATACAAGTACACAACCGCACACTTAC
ACACACGCACACGTAGACAGTGTGTACTGTGACATCTTTACAGAATGCATTGCGCGAAAA
AACGTTGGGTAACATAAATTTTTGCTTGCAAAAATCTTTATTGGGTAGCGTGTAATAAGT
AATAAATTTTTAGTATGTAACTGTGATTCAAAACGAAAACAATGTAAAATAATTAACTAA
TTGGTAACGAAATAAGCAAAACTGATTGAGAAAAAAATACCAATGATTAGTAAAAATCTA
TATATGCTAAATGTGTTTTCATTTTGGCTTTAGTTGGGTCTAGAACGCTTGTTA
Homology
Chromosome 3L
From 14875055
To 14875408
Strand +
E-value 0.0