Japanese | English    

BAC Detail View

DME1-014H15.F
Clone Detail
Accession no AG930025
Direction 5'
Sequence GAGCTCTAAGGTGTATTTTATGAGGCAAGCCGAGAAGTGGAGAAAGTGAAAGCGGTTAAA
AGGGATTAGGTGCGATTTTTTCGAAAGTTAGGAGAATTAGGAAATATTCAATAGGACAGA
GGATATTTTGGTTTTTATAGCTTTCATTTTAATATTTTTTCTAATGTATTAAAATAAAAC
TGCCTTGAACTTTAAACTAAACTGAATTGATTTCAAACCTTTAAAAATTCCCATTAGAAA
ACACGCGACTCTGGTGAGACATGTTTTCTTGGAATCTTAAGTAATCTAATTTCCTGGCCA
TCGATAACTGTTTGATTTATGGAAAAAGTAAAAAAAAGAAAACAAACTTTTGCCTAGGAA
ATCACTCGAGGGACTCTCCACATTCGAGTAGCTTCAGTTGGAACTCTTCTGTACATTGGA
TCTATATTCCTTACCGAGTTTTCCCATCTCCATTTCCCTTTATTTTAGTTGCTTTCTTTT
CATTTTTTTTCCTCCTTTATTATATATTTTTTTTTTTTAGTTTGCCCTGTGTTTTCATAA
CGGATATTCGAAATGGCTGCTGCGGCGGCTTTA
Homology
Chromosome 2L
From 9878789
To 9879116
Strand -
E-value e-163

DME1-014H15.R
Clone Detail
Accession no AG930026
Direction 3'
Sequence GTCTGCGCTAATTAAAGCCGGAGCAAATGAGACCCGTGAGCGTAACTCAGCCGGACATGG
CCAGTTATGATCACACATCGCAAGCAGATTGAGATGTGGACACTTGGCTTGTCCGCCAGT
GGGGACAATCGAATCGATTCATTTCGATTCCGTTTCATTAAAGACAATTGATTCGTTGAC
AAAGACGAGAGAGATTCATCTCTCTTTTTAGACAGTCAAGTCCTTATTTCATTCAGTGAT
TGAAGCCCTCTGGGGTTTATTGACTTTGTTTCTCTCAGTGTGATCACTTGGGGCACTCTT
GATCGTTTCAAGTGTCAAGTGCAGCGGCCCACACACTTAATGGCCTCAGCTATTATCCGT
TTATTTCGGCCATTTTAATTTTGAGGTGCTTTAAGATCAAGGCTTGCGAGCAGAGCGAAG
GTTATTAGAAGCACGGCGATCGGGTTTGGGGCTACTAATCTAGTTTCTAAATGTAAAACC
ACGGTTATTCCCCCTAATCGAACCGTTGTCATCTTAATTATGTAGCCCATTCCATTGATT
C
Homology
Chromosome 2L
From 9783410
To 9783950
Strand +
E-value 0.0