Japanese | English    

BAC Detail View

DME1-012O23.F
Clone Detail
Accession no AG929107
Direction 5'
Sequence GAGCTCAAGGAGGAGAAGGAACAGTTGGTACAGCAATACGAGGCCCATCACAAGGCCATC
AGCAGCATCAGCCTGACCAAGTCAGCGGAGGACGAGCTGCAGCATCACCCGCGCAGCAGT
CCGGTCACAAATCCCAGCGAAGAAAGTCCAACCACTCCTCTTCCAGCCGCCACCACGCTA
GATGAAGCGCCGGATGCAGCTCCAAGTTCCGCACAAGCAGCTGTCACAACGACTGACGAT
GCCGGTGAAGCAGCTGGTGCAGCCAGCGAGGACAAAACGTCAGAGAAGACGGATAGCAAG
GCGGCTGGCTGGTCGCATGATGCCATGCCCGAGAAACAAATGAAGGTGTGCGAAATCTGT
GGCGCTTTCCTGATAGTCGGCGATGCACAACAGCGAATCGAGGACCATTTGATGGGTAAA
CAGCATCTGGGCTACTCCAAACTGCGCAACGCCGTCGCCGAGATCAACGAGGCGCGACAG
AAGGAGCGCGAGCAGGAG
Homology
Chromosome X
From 6566709
To 6567206
Strand -
E-value 0.0

DME1-012O23.R
Clone Detail
Accession no AG929108
Direction 3'
Sequence ATCGCTGCCCGGCTACAGTTGCTCCATGGAGGAGGCAAACGGTGGATCTGGTGTCGGATC
GGCGGCTGGAGGTGTCAGCTCAGGATCCGCTGGATCGGGAGTCGCGAGCGAACAGGGTGG
CGCCAACAAATTCGAAAACATCAGCGATAATGGCAGTGAGATCAGTGACGAAGGATACCG
CAGTTTGGGAGTCATACAATCGGGAGCCCAAAAACGAGAGTCCCTGCATAGTCAGGCTTC
CATTGAGGACGCTGAAAGCAATGGTGAGTTCCTAAATTTCGCTTTGATTTTTGATGTTCT
CACCCAATGCCCTTGTCATTTTCTAGCGCGTCTGGATCAGACTTCAAGTGACTCGCAAAT
CTCGCCCTCTGATGAGCCGGCGGAGAAGGCCACCACGGACATTCTAGAAGAGGAGGATCT
AAATGGCCAAGATCGAGAGGAGGACCAAGAGGACTACTCGGTGTGCGATGGGCCACAATC
GCTGCCGGCAATTCTCAGCGGAGCCCATAAGCTAAGCGACAAATTTGAGCAATCCGGTGT
CTTTATAACCGATGA
Homology
Chromosome X
From 6542913
To 6543464
Strand +
E-value 0.0