Japanese | English    

BAC Detail View

DME1-011G04.F
Clone Detail
Accession no AG928285
Direction 5'
Sequence GAGCTCGTTACAAAGCGCGGCACTTTCGGGCCCCAAATATCCTGGCGCAAAAGGACTCCT
TACCCCGTAACCACGCCCTGGGGGCATCCGTGAGTGTGTGCAGTTTCAAGTTTAATTTAA
AGTTTAGTTGTAATTTTGAACATTTTTCGTTGCGCGGGCAATTAAAAATTCAACGCGCAA
TCTACAAAATGAACCCCCCAAACGAGCCGTAAGCAAAAATGGAAGAAAAAATGCAAAACA
AAAAAAAAAAAACATGAACAGAAAAAGAAAAACGGCGACGGCGGCGGAAAAAATGTGAAA
AATTTTTTGTTCCAGCCTGGAGGAGTCATTTGGCAGCTCTCCAGGACTCTCTATTTTATT
TATTTATTTATAGGATCTGTCTTAATTCGCACCACACAAATAAATGATGAACGTTTTCCG
CTTAATTATTTGCAGGACAATCTGAAGTGCATGGTCGTTGGAATTCGCAAATCTAAGGAC
TGGCAAATTTAAAACTAAATGACGCATGATTAACAAACGCTCTGCTGTTCGTTGTCGGGA
TTTTTGCG
Homology
Chromosome X
From 13346880
To 13347427
Strand +
E-value 0.0

DME1-011G04.R
Clone Detail
Accession no AG928286
Direction 3'
Sequence TATTTGGATATACCAATAGTAGTAGCTCCCTTTCAAAGCTCAAAGTCCCATTCATTTGTT
CAAACTTAAAATCATCATCTCTGTTTAGCAATGTCCTGGAATCAGCATCCTGCTCAGCAT
CCCATTGATTTCGGAATCAAAAATGGATTATCAAATCAGGCAAGCCTAGAATCTGTAAGG
AACTGATTGCTGCTTGCCGCCCCAGGTATATCAGCCCTTTTACCATTTGATTCAATTTAA
ATATTTCGTATTTCGTAATTCGTATTATTCACATCCTTACATTTTTGCGACGCAACTTGA
AGCAAAGGAAGTAGATGTTGCGGGGGGGTGTGACTATGTGTGCTTTTCCAATTTTTTTCT
TTTTGTTCCGGAACGGAAAGGATGGAATGATGTGAGAATGGGAGGATGGATATGCTGGTT
GGGTGTGGGGCAAACAGATTGTGTTCGATTTGGGGGTACATACCTCAACGCGAACCATTT
GGGAGGAGAGCTCGTTGGCGGCGTCCACCTTGAAGAGGCATGTGGGCCGCAGTTCGGTGA
ATTTGAATAGGAACATGGTGATGACGATGATGCCGAAG
Homology
Chromosome X
From 13471583
To 13472160
Strand -
E-value 0.0