Japanese | English    

BAC Detail View

DME1-009G19.F
Clone Detail
Accession no AG927112
Direction 5'
Sequence GAGCTCAACTGTGACCAAACGCTGCTCCCTGGGCCACACAGACTACCAGTACGAACAGAT
AAAGGACGAGGTCATTTTAAGAGTGAAACGACGGGGTCGCCGACGAAAGCCAACACCTAT
GGAAATACCTACGACTGCTGCGGACAAACCAATTTGAAATAAAATTGTGTAATCGATTTG
AAGTGTCCACTTCGAATTTATTTATATATATTACATTGCTGCACCCAATGATTGGGTGAA
TAGGTGTTAATTCACGCGATCAGGACTTTCGATCATCTTGAACCATGAGTAGGCAACGAT
CCAAAAGTAAATGGCTACACCTGTGGGTTTTGAATTATTATTAATAATAAGGTACTTAAA
ATAAGCAAACTATTCTTAATTCTGGATAGTGTGAAAATATATCAAATATTTTGCAAGCTT
TACCAAATCCGCCGATGATAAGGAATAAGGTCAAAATCACAGGGCCAATTGCGACGCAAA
CATAAATGAAAAACATAAGATCATAAACAATGCGAATTGCGCCTGTTATTAGATA
Homology
Chromosome 2R
From 9097144
To 9097678
Strand +
E-value 0.0

DME1-009G19.R
Clone Detail
Accession no AG927113
Direction 3'
Sequence TTCGGTACTTCTCTAACTGCTACACGAAACTAATGAAAATTTATTGATAATAAATTTAAT
ATGTTTTGCGGTTGGATGTTTTATGTGTCCCCACATAACTTCGATATGTACATATATGTA
TATGTATATGTACGTTTGGAGTTTCGAAATCGATAGTCAAAGCGAGGATGTCTAGCCCTC
GATTTTCAGTGCCAACGAATCATAATTAATTTATGGCAATTAATTAGTTGGCCATGTAAT
GCAGTTGGCAATGCATGATGCCAATTTACCCCATGCCCACCCATCACTTTTTATCAGCGA
CCATTATCATCTATCGTCATGCCGCTGTTGACATTTCATTGAGTCGAGCTCAAACTTCAT
TATGTCCTGCAGCGGTCCTGGCGCCAGGACGAAGTCTCATGTCGTGTGGGTGCGTGCTGT
GTGTGCTTTTCCTCAGTTTTCCCCAGTTTTCCCCACTTCCCTCCAGCTTCACCCATTCCA
AGCCGCACCAGCCCATCCTTAACTTGTGCTCCGTCTTCCTCTTGGCCCGACATCTTGCTC
TGCTTCTTCTGGTTGTG
Homology
Chromosome 2R
From 9208463
To 9209000
Strand -
E-value 0.0