Japanese | English    

BAC Detail View

DME1-004F08.F
Clone Detail
Accession no AG924509
Direction 5'
Sequence GAGCTCTCAGAAGAGCCCAGCCCTCGCTGTTTGTTGTTGCGTTATTATCATATGATATCA
TCACCCGAAATTCCTCGCTCGCAAATAAATCCTACATCTAAATAAATTTCAAATTCTTAG
CTCAAAACACACACGTACGGGCTAGTATCTCCCGCTGCTTTGTTTGCATAGCGTCGGCAG
CGCTGCTCAACATCATAAAATATTAATTAATTAGTTGAGGAAAGAAAAAAAGGTCTGTCG
GTTAGAAAGCGTGCTCGGGCAGAGAGATATAGGAGATCTTGGCAGTAAAGATAAGCTTAA
TCATTAATTTCCTTTGTATTTGCTCAGCCTTAAGCCCAAACAAGTTCAAGTTTATGGCCC
GATCTGTCTCTTGTCTTCTGACGTCGAACGCCGCTACACTTGCTCTTGAAGAAGTTGGTA
AAGTTCTGTTTATTGACTCGGCAAACGATGAGAAAATCAGCCAAAAATTGTTCGTGCCCC
TGCTGGCTGAGCTGATGTGGTCGATAAGTAATTTTATTTTTATGCCATGATTAAATAACT
CTTTATGTGAGAAGTCGAGAGCACGAAACTTGTTTCGAAATCATATTAACCCACTAACGG
TTTTCTTAGTAGCTA
Homology
Chromosome 2L
From 2473910
To 2474524
Strand +
E-value 0.0

DME1-004F08.R
Clone Detail
Accession no AG924510
Direction 3'
Sequence TATGAATAATGTAAAGTATTCCGGCTGACACTTGCTTCCGAATGGTCGGTCGTTGCCTGC
CACTTCCGCTCCCCAACTGGATGCACTTCCAAGCGAAGGCGGTGGCGCTGGTGGTGCAGA
GGGCATGGCAGTGACTCCCCGCCCCGCTGGCGAGCTGTCATTTTCCTGTCCAACTGTCTG
TCCCCGTCAGTCCGGGACGTCTATGTGGTGTCAATTTGATTGCAAAGGTAATTCAAATAA
TCTCATCATATCTCAATCTAGCTGTGTATCCTGCCCTACTCATTCATCCCCAGTCCGGAG
TCCTCATTCCGGAGTGGCGTATCCCAGTCCTCGTTCGAATCAGAGTTCCGCCCTTCATTT
CAACGACAACTTCAAAGCGAGCACTGCAAATAAATCAAATTAAATTTAACATTTTCTTTT
TATTTGGCCTTGCTGTGTGGGAGAAATTTAATTTTCAGCAACCGATTTCGTTGGATTTCA
TTAAAAAGGTTCTATATAATTGAATTGATTAAGAGATGGAATATAAAAGTGCGAAATGTA
CACGCACATATTTATATTTTAATCGGGCCCA
Homology
Chromosome 2L
From 2609406
To 2609975
Strand -
E-value 0.0