Japanese | English    

BAC Detail View

DME1-002J17.F
Clone Detail
Accession no AG923532
Direction 5'
Sequence GAGCTCATTTAATTGCCTCAGCATCTGTGCATACATCTTGTTATGTTCATCATGCATCAT
CTCCAGATCGATCAGTTGGCGTACGCGCCCATTTAAGGTCTCCCCATCTGGCACCATCAT
CATCCGGACCAACTCATCTTGGGCCGCGTTCTTAGCAATTAGTTCATTTCGACACACTTC
ATACTTGGCTCTTAAAAGCTCACCGCACTGCTTCAAATGCTGTGCATGGCTTGCCGCACT
GGCCTCTTTATCTGCAATTTGGCTGAGCATATTTTCAAGGTTTATATTCCTTTTGCGCAG
CTCCTGAATTTCAGCGCCCACATCTTTTATCTGCTTTTCCTTCTCGATTAGCTGCAGATT
GATATCGGCCAAATGTTGATCCCCGCGATCAATTATTGATTTAAGCTCAGCGCATTTATC
ATTAAGCCTTTCGTTGTCTAACTCCAGGTCGTTGTTTTTCGATGCTATATCGACTACCTT
CATATGACAACAACTCAAAATGGTTTCACACTCACGGCTCGATTCGAAACCCGACTCCAT
TGCCTCCGGTATTGTGGCCTCGAATCCATCTAGCTCTTTTGGCTGGCATCCC
Homology
Chromosome X
From 14144244
To 14144831
Strand -
E-value 0.0

DME1-002J17.R
Clone Detail
Accession no AG923533
Direction 3'
Sequence AGTTGTGGTAATGAAACACATAAAAATCAAAATGAACAACAACTTCAACTTTTAACGTAG
ATATTAAATAAATTGCTTAAATCTATAAAATTGTTCGCCCATATTCGCATATATATTGCT
TAAAGTTGTATTGCAAATATATTTTAACATATATTCACTGTACATATGTACCCCATCTAT
ACGTTTAATATCCCTTCTAAAAAAAAAAATCCTGACACAAGGCGCCTCTGGCACAAAAAA
CTCAATAAAATAAGATGACGGCGGGCAAACAAGTAAAAATCGCATGCAATTTGAAGAAAA
ATATGCGAGAAGTAAACTTTTGAAACGACGCATTTTTCCAGCTTTTCCGACGCCCGCGCT
CCCAATCCCCTCCGCTTCACCGCTTTTCCCCGCCGCATTTTGTGAGGGGTTTGATGCTCA
TCATAGCCATGAAATGTGCAAGTGCGTTAGCCCCAAAACCAATTTTCAGTAATGACTGCA
TTTTGCCGTCGTCTCAGCTTTTCCACAGCCAAGCCCCCCCAACACACACACACTCCCGTC
CCCTGGAAAGGCACCACCCGA
Homology
Chromosome X
From 13956757
To 13957318
Strand +
E-value 0.0