Japanese | English    

BAC Detail View

DME1-002D15.F
Clone Detail
Accession no AG923331
Direction 5'
Sequence GAGCTCAAAGGAAAAAGGAGAACTGCAGCGGTAATAATCGTGCCAAAGCGAAATAACGGG
AAATACACACACAAACACTTTCAAAAACACAGACAGGTAGCGAAAATTGACTGGAAAATG
TTCATACTTTGATTTTTTGCGTTCATTTCGTGGTGTTTCTTGTTCATAAGATGTTATTCG
ACATCTTTAGAAACTCCAAAAAGATAATATAATATACAAAGGTCCACTTTTGGAGAAGTA
CATACCTAATACTGAAAACTAACTGTTCTCCGCGGCAGAGAGCGAGGGAGATGGCTATAC
AAAAATGTCTACGTGACAAGAGGCTCCCTTTTTCATTTCCCTTTGTGTTTTCCAGTTTCA
TTTTTTTTTTACTTTTCGCCAGATCCAGGCAAAAAAAAACTAGACAGTCGTGGGGAAAAG
AGACAGTGAGAATCACCCCCAGGGTAAGCGAATCCAGTCATTTACCGTTAGGCGGAGGGA
TCAGTTTTTCGAGATTCAGTTATACACACACACACAACACATGGCCCATATGGAAGGAAG
GTGCAAGGCATGCGCACAAAATACACATGAAGAAAAACTACTAAGGATAATGATGATCAT
TTCAATTTGATG
Homology
Chromosome 2R
From 6422811
To 6423420
Strand +
E-value 0.0

DME1-002D15.R
Clone Detail
Accession no AG923332
Direction 3'
Sequence GATCGGGTGTTTTGTGCCAGTGGACCCCATAAATCCATCCCTCATGTCCATATAGAACCG
ATTCCAAGCTCACTGCATACCAGGCTTCTTTCCCCAGTTGTAGTATCTTCTCCTCCACCT
TTATCTCATCGTCGTTGTGGCTCAATTGATGCAGATCAACCCGATTCTCTTGCATTTGCT
CTTTGCTGCGCGGCGCAATCCGCCAGAGACGAATAAAGTTATCCTGAGAGCCACTGGCCA
GCAGCAAATCCTCGCCATCGACAACGAAATCCAGACCTCGAACCCAGTCTTCGTGGCCAG
TGAGCTTGTGTTTGCGTTGGAACTGCCGATCTAGTGAATCTCCTTCACCTGCGGTTTCTA
CCTGTTCCGACCACAGGGAAACAGTCTCGTCATCGCCACTGAAGGCGAGCAGAACCTGGT
TGCTCTTGGGCAGCAGCTGCAGTCGAAGACAGAAGCAGAATCCGTCGGATAAAGATATGG
TTTGAAAGCACACATAATTATTATCCTGGAAAGTCCACAACTTGATGGTGGTATCTGCTG
CTGCGGTCGCCAAAAGCCAGGAGCCATCCTGTTGGCGAATTCCATCCACAG
Homology
Chromosome 2R
From 6533718
To 6534308
Strand -
E-value 0.0