Japanese | English    

BAC Detail View

DME1-002C10.F
Clone Detail
Accession no AG923299
Direction 5'
Sequence GAGCTCCGGGTAGAGTGCACCACGTTCATTTTTATAGCCCAAGCACTGCGGCGAGGCAAA
CAGATGCTGGCTATCCTTGACGTGCTCACAGGCTCTCACCCAATCGATACCGTTGCGCAG
ATGAATGCCCAAAAAGGCACCCCGAGGCAACTGCTCTCGGATGAAATCCTTAGATGCTTC
CCTATACCGTTGACTCCACTGCAAGTAGCGCTGCAGCTTGCAGTTCTCTAGCTGAACAGG
AAAACTAGCCGGAGCTCCGGTGAACGCGAGTACGGGATATGATTCTGCAGGATATTTGGT
CTGCCACTTGGCAGCCTCGTTGCTATGATGCACATCAAAATGAAGTGGCGCATAGAACTC
TGACCGCACAAAGTCTATGTGAAAAGTGTCCCAAAAGGGACCAAAAGGATTGCCATCCTT
GGCGTGGCAATTGGGCTTGTCTGGATCGTTCTTCTCCTGCTGAAGGCTATATCGTTCCTT
GTAGCAAAATGACACTCGCTCCGATTCTGGCCAAATGTCGTCGGCCAGGTGCCACATGAA
ATCTGCCATG
Homology
Chromosome 2R
From 10049322
To 10049871
Strand -
E-value 0.0

DME1-002C10.R
Clone Detail
Accession no AG923300
Direction 3'
Sequence AGCTTAAAGAGCTATTAAGCCATACCAATTTGTTGGGCGTAAAATATCAACATTTTGCCG
CCCAATAAAATTAATGCCGTAATTTCTGCCTTTTCAAACAATTAAGCATTCCCTCAAGTG
CTGCGAAAATACATTATTCATGGCATTATCTTTGCATATGTGCGGTTATTATTGGGTATA
TTATAGCCGGTCACCAACCTTAAACCAAAAGGCCACCTGAGCCACGCAGCAATTTCCAGA
AGATGAAAGTATCACCGGCAGCACAAGATATCCGATCAGATGCGAGTCAAATATTGCGGC
GTGTAAATGCAATCAGTATTTATTTGATTATCGATTCCAACGCAGTGCAGCAGGTCACAT
TGCGTATACGCCGAGTGGGTTGTGGCCACATGGCATTTCCATTTAACATTTTTTTTTTTT
TTTTGCATCCATCCAGTGTTGTCGGCATTTGTTTATTTTCGTTCACGTGTAAATTTGTAA
TTTGTTTGGTATTTAATTAAATAAAAGAAAACGCCAACAGCAGCAACGAAATTAATGAAA
ACAAAACAATTTAATTAATAACGAGGAATCTTGTTGCCGTTGGCAATGTTGGATGTTCT
Homology
Chromosome 2R
From 9973344
To 9973942
Strand +
E-value 0.0