Japanese | English    

BAC Detail View

DME1-014C16.F
Clone Detail
Accession no AG929834
Direction 5'
Sequence GAGCTCCTCAACCCCGGGATCCCTTACTCCCGATCCCGATTCCCGGACAACAAAGCGGCT
GGCTGCTGGCTCATACGCAGTATCTTAACCCAGCCATTGTCGTCAGCCATTGATTACGTT
GTTGTTGTCACTCTGGAGGTCCCTATTCCCAACCTCCTGCCCCGATGCCCTTCCAGCATC
TTGACGTGACTGCCGGCTGCGTGTTGGCCTTAACTGCAGTGGCTGAAGCTCTCAATGGAG
AATTTAACAATTACATATTGATTGCCAGCGCCTCGGAATAAATCCCCCGCCAACTGTTGC
ACGCGAAAAACTTTGCGATAACCAAGCTACTCACTCACTCGCTCACTCACTCACTGACTC
ACTCCGTCCTCCATTTTCAGATACAACATCTCCTGGGCCGTCGACTCGCACTCTCCCATC
GAGGAGTACAAGCTGTCCTTCCGCAAGTTGCCGCAAGGACACGAGGTCGTTGGCAATGCC
ATCGACTCGTCCTCCTCCTCCTCGTCGATGTCCTCCTCCTCGTCCCAGATGTACGGCTCT
GGGCTACATGCGCATCGGATTGGCAGCAACATGGGCGGACTGTC
Homology
Chromosome X
From 13392974
To 13393009
Strand -
E-value 9e-07