Japanese | English    

BAC Detail View

DME1-012O08.F
Clone Detail
Accession no AG929091
Direction 5'
Sequence AGCTGCGTCTGCTGCCCCTTAGGAATTCTGTTGAAAGCCACGCTTCCAACGGGGCGAGTA
TGTAGGGTCACGCAGCTATCAGCAATTCCTAAATTCCTAAACATGCCAACATTGGAGACA
CAATTTAGATCTACGGCACCTTAGCTGTGCGGCATTATCTTTCGTTATCTAATCTCTCCC
TCTCGCGAGCTCTCTGTTGTACTCTCTCTGCAATAACGTTGTTCATTATCATTCGCTTTT
CGTTATCCATACATATCGCATTGATGCAAAATCTCGGTTTCTAAACTCAATAAAAATAGA
TCGTTCGAAATCGAAACATAACCTCGTCTTTTTAATTGCTCAATCATAGCTAATAAAAAA
GCTTATGAGCTCAATAATGCTATTGGCATTTTCATAATTCTGTATATTTTGCTTTTCGTC
ATTTTGTAAGTAGCTTGAACGGTGACACTAGAATAACAAGATGCATAACGGCATTTACGT
AGTCACTTTTTTGGTGACGGCCAAAATTGTCCTG
Homology
Chromosome 2L
From 2777786
To 2777822
Strand -
E-value 5e-05