Japanese | English    

BAC Detail View

DME1-012N15.F
Clone Detail
Accession no AG929068
Direction 5'
Sequence GAGCTCGACCATAGCATTCTCTCTTTGTTCAACTAAACTTCTGACTGCCTTCATCCAATC
ATCAGGCAACTGAGATTCCCCAAGCTTATTCAATTCAAAATATGCAGCCCGGCTGAGAGC
GTTTGGATACCTTTTCTTTAATCAATTTCCTGATCAATTTCCGATTTCGTAGTCATAGTC
TTGTAAAGGGACTTTTTTCATTATCATCGTCATTGCACGCGAATTACAATCTGTGACTAT
TTTAAACTTTTTTCCCAGGACATACACACGTCATTTTGTCAGTGCTGCAATGACTCCTAC
AATGAGTTCGAATGAGTAATATTTTTCCTTACACGGCTTCGTCTTTCGACTCGTGTATAT
GACGGTATGTAACTGACTATCCCTTTGCAACAGCACTGCGTTGAAACCAAACTTAGACAC
GTCCGTATATATCTCAATAGCCAACTTCGAATCATACAGTTTAAAATCTGGTTTACTAAT
CAAAGCTGAAAGAACCATCATCGGCTCGACAAAAACTATCTCTAGCTACGCCAAAACTGT
TGGTTAAGCCACCTTTGGCGCAAAAACGATTTCATCTCGTTGCTTTAAGGTTA
Homology
Chromosome 3L
From 23112458
To 23112485
Strand -
E-value 2e-04