Japanese | English    

BAC Detail View

DME1-011H01.F
Clone Detail
Accession no AG928314
Direction 5'
Sequence GAGCTCTCCTCCTGCGGCTTTTTTGCTTTTATCTGATGCACAGATACAGATACAGATACA
GATACTCGAATATACGAGCAGCTTAAGTCGCGGGGATTACAAGTCGTCGTTTTGGTTCAA
GGTGAGAGATCCAGCTTTGGACGTCAGTCTTCCAACGTCTTTTACACTAACTGGCGATAC
CATATTCCGCTAGTGCGATGAGGCCTTCCCAGTTTGACAAACACCATAAAGCGTAAAAAA
GCGCGATATCAGGGGGCGATTTGTTTATCATCTGCCTGATAACCGCGCGCATTTCGGAAG
GCCTGAAAAAAACGGTGCAAGTCTGTCACTCGTACTCAGGCATGATATCACCAACAAACA
CTTCGCAATGGCTATTCTGGGAAATTGGCTGGTGCAGGATAAGA
Homology
Chromosome 2R
From 12044312
To 12044715
Strand +
E-value 0.0