Japanese | English    

BAC Detail View

DME1-010K09.R
Clone Detail
Accession no AG927817
Direction 3'
Sequence GGCCTACGGTTACCTAGGTGAGGCCCCAGCTATAGAAAGGGATTCCCAACTATCGCAACA
CAGCTCTGATCGAACGGTTGATCTGGCAACGTCTCCCTTTCCAGATCTCCCACTGCGCCA
AGTTGGCAGCGCTATCAGCTGTTCTATCCGCTGCGGGAAATCGCTAATTTGTATTTAGCT
ATTTACCTGCAACAGGCGTACATTCAGTTCGCGTGATGGCTGCGCCAAGATATGTCACGT
TTCCACTGTGTGGTTCTGTCAGTTTGCCGCACACACCGGTCGACTCAACTCCGAAAATTA
CGAATGTTTTGCGCAGCGTTAACATAAGACGTCCGTCTGCACGGCGATGTCAAATGCCTG
T
Homology
Chromosome X
From 6329168
To 6329269
Strand +
E-value 3e-27