Japanese | English    

BAC Detail View

DME1-009F14.F
Clone Detail
Accession no AG927066
Direction 5'
Sequence GAGCTCTCGCACATCGGCTTAAACATCTGCACCTGCAAACAGCGACGGCATTCGCCGTGT
AGTCCTGACTTGTCGACTTCTTTTTATTCCCGTTCGGCAAAAAAAAAATGAGAGGTCAAC
GTTTTTCGACAATTTTTATACCCGTTACTCGTACAGTTAAAGGAGTATACTAGATTCGTT
GAAAAGTATGTATGTAACAGGTAGAAAGAAGCTTTTCCGACCATATAAAGTATATACATT
CTTGATTAGGATCAACAGCAGAGTCGATCTGGCCATGTCCGTCTGTCTGTATGAACGTCG
AGATCTCAGGAACTATAAAAGCTAGAAAGTTGAGATTCAGCATACAGATTCTTTAAACAA
AGACTCAGCGCACAAAACTTGTAATGCCGCCGTCGGCAAAACTGCTGGATTAAATTCATT
TCACACACAATTTATACAAATTGAATTCTAAAGAGGAAGTCTTAATGAATCTCCTTAACG
ATAGAAACTTTCAGTCATTCAGTCAATTCCTACAACTCCCGCACAAGCAACT
Homology
Chromosome 3R
From 27797918
To 27798027
Strand -
E-value 4e-21