Japanese | English    

BAC Detail View

DME1-002E23.R
Clone Detail
Accession no AG923378
Direction 3'
Sequence GCTTATCCACTCCTCGATGCTCCTGGCTCCCCGATGATTTTGCATAGCACACTTTTATGC
TGATTGAGTGCGGCTTATCTGCACTGCCTTATGCCATATGCTATATGGTATATGGTATAT
GGTATATGGTTTATTCCGCGTGTGAGGGAGTGCGGTAAGCCCGCCTGAGTTATGACATAA
CTCAAACGATGGTCGTTTATGTCAATTGTAAGCAAATCAGCGCTCGGGAATTATCCATAA
AAAAAAAAGGAGAGCGAACATAAGATGGCAACCGCAGCGAAAACCGAGACAAATGTCATT
ATTAAAATGGGCATAAAAATAACAAATGACATATGTACGAATGTGGAGCGAGGGTGGATC
GAAGACTCCATTCTACTTGTATGCCTAGATTTTACCGAAAATTCAAATAGCATTTAATAC
TTTTCAATATTTGTGGCATACATATTAATAGTTTATTTTAATCAACTCTCGAGTTAATTG
GCTTCAATTGCTTTCAAAAATGTTTCGAAACTAACCAAAGCAATCGTTCGCTCAACATAT
CCTTAAAGTTCTGAGTTTATAGAACAACAAATGCTATTTTGATACCATCCCTCGCATTTT
GATGGTC
Homology
Chromosome 2L
From 19591301
To 19591895
Strand +
E-value 0.0