Japanese | English    

BAC Detail View

DME1-016F05.F
Clone Detail
Accession no AG931124
Direction 5'
Sequence TATTTATATTATTAAATATAATTTAGGCAAAATATGATTGCCTTAATTATAATATTAGCT
TTTCTAAGACCCATTGACTAATCCTTCTTTTTGATTTTTTTGTTCAATTTTCTTGCAGCA
AGCGGCGTTAAACGAGACACAAAACAAGTTCGACAAGGAGACGCGGCAAATGCATTACGT
TATAATTTCATTAAGGACAACATTCTTTCTCTGCCGCCAGTGAAACAACGTAGCCGGGAG
ATAAAAGAGAGGTTGGAGAAGAAAGAAGAGAGCTGGGGAAAGGCGTGCGGAGAAAGTCAG
AAAGCCGCAAAAGGCGACAATAGCCCCCGAGCCCATTGCCTACTTCTGAGCGCTGTCAAG
CGCGAATCAAGAGCCTGGCATTTTTATGAAATTAATACAAAGGACGTTGAAGGAGTAGAG
GCTGAGC
Homology
Chromosome 2L
From 11621070
To 11621496
Strand +
E-value 0.0

DME1-016F05.R
Clone Detail
Accession no AG931125
Direction 3'
Sequence AATTTAAATCTTTTAAATATATAATATATTTACATTATTTACATTTTCAGTCAGTAATGT
TTTTGTCAGAAATGCGCCCAACAATAACGAATAATGGGTACTAAAATTATGTCCCATGGA
AGCACAGACACTCCTTCAATTTATGGGCATGTGTGGAATATGCGAGTGCAGATGTCAAAG
CCAGATGCCAAACAAACACCTCAGTTCATGTAACGCCACCACTCGGAGGTTCAAGTAGAC
GCTTAACATGCAGCCAGCGGCGATGAAGCTGACAGTCTCCTCGTGTTTCTATGATTCCTA
TGATTCCAAGACGGACTCAACTCGTTCCGAGGCTGGAGTAAATTAAAAAC
Homology
Chromosome 2L
From 11708659
To 11709008
Strand -
E-value 0.0