Japanese | English    

BAC Detail View

DME1-015N15.F
Clone Detail
Accession no AG930860
Direction 5'
Sequence GAGCTCAAAATTAAGGCGTTCGGCGAAGGTGCGGGAACTTCTTTTGCGCCGTTTGCTTCG
GTTGCCACTACTGCTGCTGGTCTGGACGGCCGGAGGATTCTCCAGGGGAGCAAAGGCGTC
GATCTTGTTGAGCAGGGCGAGCAGGAACTGATTGTGCAGGTGCAGTTTGTCAGGTGTTAG
GATTTTCCGCGACTCCGCATCGAATTCCTCCTTAGTCCAACGGCTCCGAAACCAATTCTT
CATGTTGGCCCGGTAACGCTCCCAGTTGTCGCCCAGAGCCACCACTAGCGCCTCCTTGGT
GGCCAGAACTCTGTCGGTAAGCATTTTAGTAATGGGAATAACAACTAAACAGGAAAATCC
AACTGTTTGCGAATTGCTATATAAACAAATGAATGCAGCTGATTCGAGTGACCGTTCAAA
GAACGGCTGAAAATACCAGATACATTTGAGATAAAAACCGTTATTTTTGAAGAACCCTTT
AAAAAAATATTGGTTTTAATCTTTAGTGTTCACAGTTTTTATT
Homology
Chromosome 2L
From 11992794
To 11993316
Strand -
E-value 0.0

DME1-015N15.R
Clone Detail
Accession no AG930861
Direction 3'
Sequence CTGATCCTTGGCTAACTTTCAGGTTCATGCCAAGCTCTTGGCCCTTTAAATATGCTAATA
ATTTTCAACGCTGCTTTATTAAATTTCTATGGCAACCGAGTAAAATGAAATGCTCCCCAA
AATGACATAACTTATTTAGCTTTCGCCTGGTGCCGCCGCTCAAAATTAACGCCGTCGACC
GAAAGGAGTGGGGGATTCTCATGATACACCCGGAAAACCGGAAGTCGACACACAACGCCC
CCCTTTTTCCGAGTTTTCGCCAACTGTCGGTTTCATTTTATGGAAACGCAGAGGAAAGTG
GCTTTCGCCTTCTCTCCTTTTTCTCGCCTTTTTATGCCAGCTTTAAAATCAGAATTGTGT
CGTTAAAGCGAGAGCCACTGAAGTTTAATGCAGAAATAATTATTTTATTTTATGTGTGGC
AGCTTTAATCATTTGCCATACGGAAAAATCTCTGCTGATGCGGCAATATCTAGTTTAATG
TGCCGGAAAAAATGACTGCACTTACGATAGTTCAAATATGTTTGTAATTTAAATTAAGTT
TACTAATGCCGAAAACGATTTTTAATCGTCTGCACGTTTTTGCCATTATATTTAAGTAAA
TGA
Homology
Chromosome 2L
From 11909974
To 11910576
Strand +
E-value 0.0