Japanese | English    

BAC Detail View

DME1-016I20.F
Clone Detail
Accession no AG931246
Direction 5'
Sequence GAGCTCTGAGGTTGCCCCTCGTATCAGAGGCACCTCGTTTCGGGGGTTGGTCGTCATTTA
GTGGTAAATTTCCGTCTTAGTTGCCAGCGAACGTCAGACGTGACATTTTGCAAATTCCGT
TTTCAGCATTTTGTCGAATCGTTCCAGCATACATGTGCCACTGAAAGTGGATTCCCAGCA
CCACCACCCATTTGCCTATTGATGCATAGCTGCCAGTGGTATCAGAGGATAGGGGGGAGC
ATGTGTGGCAAAAGGGTTGTAACTGGTTTTCTAGTGGCTTCCGATTTTTTCACTGGCCTT
CAACGATTGTTGTTATGGTAAAGTTATGAGAAGTGTCTAATGCCATTAAAATATTAAATC
ATGGATTTATATATTTATCAGAATTTGCTAGGCCTTAAATTAATCGAAGATATTGGTGAA
CTGACATTTCCGCTTTCATATTGCTTATAGCTGGAGGGTGGAGATGGAAAGGGATGCATC
GGTTATGCTATATTATTTATTCTACGGCATACCTTATTATTTAACCACAAATAAATGCCA
GCAAAGTTTAGGATTTCAGCAAATTAATGCCATCGCAATGGACGTTACTATGGAATCAAC
TTTCCTGCTTACTGT
Homology
Chromosome 2L
From 11650597
To 11651211
Strand -
E-value 0.0