Japanese | English    

BAC Detail View

DME1-018G01.F
Clone Detail
Accession no AG932304
Direction 5'
Sequence GAGCTCCTCATCCAGCGACTCTTGGTGCAGCAGGTACTGGAAGTGTCCTCCGAATGGAAG
ACGAACAAGTCGGAATCGCAGTACACGTCGCTGGAGGACGATTTCCGTGTCACCTGCGAT
CTCAACTACTACGGATCCGGCTGTGCCAAGTTCTGCCGGCCCCGCGACGATTCATTTGGA
CACTCGACTTGCTCGGAGACGGGCGAAATTATCTGTTTGACCGGATGGCAGGGCGATTAC
TGTTTCATACGTAAGTAGAAAATGGTTTTTAAATACGCAATACTCTGCGTGGGAGGGGTT
GTCTTAAAGAAGAAGGTTAAATAGCAAAGGGTACTTTTTGTAAACTGGGAATATATCTAG
AATAGCTGGTTTACGTTTCAATAGATATAGAATTTTCCGACTAACTAGAGTTCTTTGTAA
GCCTTTCTCCCCTATGATTATTTCGTGATTGGTTGAAACATTTACAAAGCATAAGCTCAG
CCTTAGCTAACCACACGGATCAATAGCCTCCATCGCCATCGGTACTCCCATAAGCATTCT
TTACGC
Homology
Chromosome 3R
From 15137242
To 15137787
Strand -
E-value 0.0

DME1-018G01.R
Clone Detail
Accession no AG932305
Direction 3'
Sequence CGGATTGCCGTCATCATCGGTGCGCATGCTCAGCGCGAACTTGATAATTCCCACGCCCTG
GTAGTCATCGTCGATGGGTATGTTTCGGGCCCACACCTTGCAGCTGAAGAAGGTCTTCGC
ATTCTCGGGCATCTTGTTCATCTGGATGGCCACCACGCGCGTCACTCCTCTCATGTTCTC
GGAGGCCTCGAAATATGGACCCGGATAGAAGACCATTTCGGGCTTGGGCCCATTGGTCAC
CTCGCAGGTGATTCTAAATCTTGGGCGTGTTGCCCAGCTTGCCCACGGTGTCCTGAAGGC
TCGCTGGCGCCTCCTTGGGCAAGTCATCTGGCGTGTCGTAGGTCTCCGGCACATAGCCAA
TAACCTTGTTCAGCTTGATGAAGACGGTCGGCTTTTCGGTGGCGTAGCCCCACGTAGTGT
CCTGGTTGAAATCGGCGAAGAAGTCAATGGCATTGTCGTTCAATTTGTTCAGAAAATCGT
CGATGCGGTCCGCAATCGGATTGACCTCACTCATGATGTGCGTAAAGTAGGCCAGCACGG
ATCGATTCTGGTTGGGCACCATCGACAGACCCGGCGGACCCTTGAGCCAGCGCGGCTTAT
TCGGATCAATGATGGCCAGCATAAAGATGCCCA
Homology
Chromosome 3R
From 15052978
To 15053609
Strand +
E-value 0.0