Japanese | English    

BAC Detail View

DME1-009M11.F
Clone Detail
Accession no AG927302
Direction 5'
Sequence GAGCTCTGGTTGGTCTGCAGTGCCTTGGACAACTCACGCTCTTCGTTCAGCTGCTTCTGT
ACATCCTTTAGCCTACAAGAGCACGAAATTGATTAATATTCATTAACAACGGCGATGTTA
ATGTATTGTATTTCTTACTTAGCTGTATGCTGGGCCAACTTGCGCTCCAAATTGACCTTT
TCTTTCTGCATGTTCTGCTGAAGCTGTTGAAGCTCGGAAACCTCTGTCTTGGCGTCGTTG
GCAGTCGCCTTGTGGTTCTGCCACTCCTGCTCCAATCGTTCCATGCGCTCCTCATAGTAC
TTGCGCTGTGTGTCCAGCTGAGAGGTCAACAGGTATGTGAACTCCATCTGCATGGAGTCA
ATCTTTTCCTCGCGCTCATCTTTCTCGGTTTGCGATGCCACCAGCTTGCCGTCGGATTTG
TTTTGAAATAAGCGATGCACAAAGTTGTCACCGGCATAGTCCCATACGCTTGAGGTGCCC
AACTGCATGGCAAAGGTGTGATTTGTGGC
Homology
Chromosome 3R
From 15004203
To 15004711
Strand +
E-value 0.0

DME1-009M11.R
Clone Detail
Accession no AG927303
Direction 3'
Sequence TGATTCGCTTTTTTTCTTTTATTTTTTGGTTGGGGCCAATGTTGTCTAAGATCGTCCGAC
GCCAGTTGACAGATTGCCCGCAGGCAGAGATTCGTATTCGTATTCGTATTTGGGCCTGAA
GTGGGAATTTGGACTTGCTTGGTGCTGATGAGTCATAGATAGGCAGGATATGGTAGTGGT
AGCTGTGGCAGCCAAAGGCATTCGCTTCCAGGAATCGGTGTTGGGTTTTTGCTTTGGTTT
CGGTTTTGTGGGAGGTTACTTGGAGTTGTATTTCAAAAGGGGGAAAGTGTTGGCCAAATC
ATTTCGGATTCTCTAAAAACTACAAAGGACTTAATTACCAAGAAAACACTTTCGTTTAGA
ACTCCATGGCAATTATCATATAAATTTTAAGTGTTACTTATGGCTGTGGCAAAAAAAATC
TAATGCCAAATGCATATATCCAAATTTTGACCTTTCACTTGAGTATATTGCTTAAAACAA
CATTTAATTTTGTAATCGATTAACATATTCTTATGACTTTGAATAATTACTTAAGGAAAA
T
Homology
Chromosome 3R
From 15110156
To 15110565
Strand -
E-value 0.0

DME1-009M11.R
Clone Detail
Accession no AG927303
Direction 3'
Sequence TGATTCGCTTTTTTTCTTTTATTTTTTGGTTGGGGCCAATGTTGTCTAAGATCGTCCGAC
GCCAGTTGACAGATTGCCCGCAGGCAGAGATTCGTATTCGTATTCGTATTTGGGCCTGAA
GTGGGAATTTGGACTTGCTTGGTGCTGATGAGTCATAGATAGGCAGGATATGGTAGTGGT
AGCTGTGGCAGCCAAAGGCATTCGCTTCCAGGAATCGGTGTTGGGTTTTTGCTTTGGTTT
CGGTTTTGTGGGAGGTTACTTGGAGTTGTATTTCAAAAGGGGGAAAGTGTTGGCCAAATC
ATTTCGGATTCTCTAAAAACTACAAAGGACTTAATTACCAAGAAAACACTTTCGTTTAGA
ACTCCATGGCAATTATCATATAAATTTTAAGTGTTACTTATGGCTGTGGCAAAAAAAATC
TAATGCCAAATGCATATATCCAAATTTTGACCTTTCACTTGAGTATATTGCTTAAAACAA
CATTTAATTTTGTAATCGATTAACATATTCTTATGACTTTGAATAATTACTTAAGGAAAA
T
Homology
Chromosome 3R
From 15110014
To 15110138
Strand -
E-value 1e-64