Japanese | English    

BAC Detail View

DME1-002J04.R
Clone Detail
Accession no AG923511
Direction 3'
Sequence CGTGGAGCAGGAATCTGTCGCATGCCCTGCGGAAATATTGATTCTCGTCTGGCACTCTAC
CGTATGCCCGACGCCCCACCGAAATTCCGCCAACGGCGTCGAGAGGCCAAAGTTTGCATT
TTTCGCCAGACTCGACCGACACCAGCTTCTTTGCAGTTTTTCACTCGGTGTGTGTGTCAT
GCTAATTATAAATCGAAACTTCCGGGGAGACTTTGTCAACTGCAAGAAGTCCTTCACTAA
CCCCGTCGCCACTCCTGCCGGATTGTCTTCCACTTTTGGCACTTTTCTGACACTTTCCGA
GATTTCTTCTCAGGCCACGCTTTAAGTGAATTAAAATCAATTAAATTAATGCAGAACGCA
ACTTTCGGCAAAATGCCTCAATTGCCGAAAACTTAAACAAGAGTTAAGGGATTCTGCTGT
AATGGGCAGTGGTTCAATGGGAACTGCTCAAAGGTTATCCATTATTACTATCTACTCAAT
TTGTTAATTATTTCTCACATGGTTTAGTTTATCATCAAGCCTTAACTTTTCTGCGATTTC
CGCCAAATAAATAAATAAATATTTTAAAATTCATATTTCAAGTTCGAAACATTCGTCGGT
AAAGTATCGACTCGTAATTTCAATGAAAACTATTTAAAAATTTCTTTTTTTCCGCACTTT
GCTTGTTTTATTATTTTAA
Homology
Chromosome X
From 21444407
To 21445085
Strand +
E-value 0.0