Japanese | English    

BAC Detail View

DME1-018B16.F
Clone Detail
Accession no AG932145
Direction 5'
Sequence GAGCTCAGCAAAACAAATGTTTTCCTTCGACTTGAACGATTTGGCCATGTCAGTCCAGGT
AGTTTCGAAATCGTGGCAGCCCATGCAATTCGGCTCATAGAACTTTACGAAGAACGTCCC
ATCTTCGGTGGTTTCAAAGAAATTGTCCACTCTCAGCTTAAGTACCGTGCCAGGAGTGCA
CTGATCTGCGGATCTTGCCTTCACACTCAAATTTGTAATTTTGGTTACATTTCCCGACCG
TTTCGATAGAGATTTATCCGATTGAGCACTCCAGATCAATAGTGAAAATAGAAAGTAAAT
ACACCGAAAGGTAGACATTTTTGGCAATTTTTACATAACAAACTTTTTTTGATCGCAATG
TGATTTCCACTGTAGATTGTTAGCTCCCAGTTTTACATTTAATGACACAAATAATTTTAA
TTTTTGTTTTTATTTCAGATAGACTTAGTATGGTTAGTATGGCTTATGGAGTTTTAGAAA
CTTGAGGAGACTTTGCTTACGATCTAAATTCACATGCTCAGAGTATGTAAGTATAGTTGG
GGGATGTGTATATGAATACGATAGCATTTAGATGGGAGATTAGATTCTGGAGTTCCATTT
AATCGGACTTCAGTGCCATTTGCCGTCCTCGT
Homology
Chromosome 2L
From 1517121
To 1517754
Strand +
E-value 0.0

DME1-018B16.R
Clone Detail
Accession no AG932146
Direction 3'
Sequence CCGGTAGTTCTTTGATGCCATTCTGGGAGAGATCGAGGAAGGCCAGGCTCTTTAGACCCC
TAATACTTTCCGGCACCTTTCGCTGCTTGGTGCCCTTCAGATTCAGGTTCTTCAGGCTCT
GCTCCAGCCCCCTAAATGCATTGCTGGCCAGGGTGACATTGTTATCGTTCAGTTTGAGGG
TGGACAGCTTTGTTATTTCCACAAAGGCGTCGTCGGGAATGTGACTGAGCTGATTTTTTG
ACAAATCCAGCAGGTTCAGCTTGCCCAGGACCTTGAGCGCCTCCACTGGCACGTCGGCCA
GCAGATTATCCTGCAGATTGAGATTCCGCAACACCGACTCCTGGCCCTTAAAGGCACCCG
TCGCAATCCTCTGGATGCCGCAGCTCGAGAGCTGCACATTGTGCAGGCTCAAATTGCTGA
AAACGGCGTCGGGAAGCTCGGAAATCGTGGAGTTGTTCACGTACAGCAAATCCACGGGCT
TCAGACGGGCATGGGTGTTCATCGCAGCCAGGAGTTGCG
Homology
Chromosome 2L
From 1600972
To 1601490
Strand -
E-value 0.0