Japanese | English    

BAC Detail View

DME1-016K10.F
Clone Detail
Accession no AG931308
Direction 5'
Sequence ACGGACAGCTTGGAACAGTAGCCGAGTCCCCAAGTAATTAATCAAGTTCATGAGCATACA
GATAAATGACATTAACGACTGCGGAATATGTGAGGCGCACAAGGAAAATGGAATCTATTT
TCGGTAATTGAATGCTCCACATATGTGTGTGTTAAATAAACAAAGAAAACATAAACATAA
GTAAAAGATGATTTATTATTTATGGCCAAAATATCTGAGTAAACCACAATTTGGCACAAA
ACAATTTCCAATTTCGATCCAATTAAAGAACCAACAATCAGAAAATTCGACGTCGCTTCG
CTGAACAATGAAAATCTCTGCGATTTGGATTATTTTAAGCTAAATGAGAACTTCACAAAG
CAAACTTCCGGTTACGCCTGGATGACCCTTGTGCCAGCTCCTTAATAGATCAACTCCCTG
GAGCCCTCGAAAAAAAAAAGTACGTTGATTTCGTTTCGTTTGGCATCC
Homology
Chromosome 2L
From 1471484
To 1471951
Strand +
E-value 0.0

DME1-016K10.R
Clone Detail
Accession no AG931309
Direction 3'
Sequence TTTTTTTTTTTTTTTATTATTTTGCTCAGCAAATTGAATTATAGCAGCCCACACACACAC
TCAGTCGCTCGTTGAGATTTTCAATTTTCCATTGAACTTCTACTGGGAAACGGAATGAAA
TGAAGGAAATCGGAGTATAAAAATCATAAAAGTCCTTTTCGCAGAAAGGGGCGATTGCAC
TGCCCTCCGGTACATGAATTATTCAGCCAACAAACTGCAGTGATAAGCACTCGTCCACTG
TCCCGCCCACAGACCGTAATTCAGCTCGAAATTCCCTCTTAAATTCGTAATAAAATATGC
AAAGGCCTTGCCAAGTGCCAGAGACCTTAAATAATAATAGGGCATAGTGGGATATCCATG
GGAAGCCAGCAAAGTAAGCCCAGACCCATCCACCAGGCCGCTAAGCTGCACAAATTTGCA
TATTCATTGCTGAAAA
Homology
Chromosome 2L
From 1592961
To 1593397
Strand -
E-value 0.0