Japanese | English    

BAC Detail View

DME1-019J02.R
Clone Detail
Accession no AG932990
Direction 3'
Sequence GAGAAACCAGACGGCTTTTTTCATTACTATTATGATTTGCGTACATTTTGGATCGCTGTC
ACAGTCGGGTTATAGGTAAATTGCAGTTTTAAACACCAAAAATGAACGCAAAGGATTATA
ATTCAAAACAGCATTTCCCTACTTTAAAAACGATTTTCGAAATTTAGAATGATATTTTCA
GATTGACAGTGTCTCAATCCACACTGCACGTTTGGCAAAAACATGGATTCAAAGCGAAAA
TGTAAAAGTTCTGGGATGGCCACCATACTACTACTATATAATAGATAACGTGTGGGTATG
GTTGGCTAGGAAGGTATACGAGGGTGGTAAACAATATGCCACTCAAAACGAATCGTTCAC
CGGAATAAAACTCGATTGGTCTGCGATTACTTTGGATTACCTACAAAAAAATATATGATT
CCCTTTCCAGACGAATGTGTGAAGTCCATAATTTCCTTTAAAAATATTCTAATTTAAATA
TTTAAGTGTTAATCATCCCAATTTCTTTCGAAATGAATCGAACCAACTTAAATTATCTTA
GGGGGCGTTATCCTGATAACCCAATTTTAATTAACCCATTTATGGATTTTTTTTTTACTT
AAATAAAAATCTATAAACAAGAAACTGCATCCTATATAAATTTTACATTTAT
Homology
Chromosome 4
From 84867
To 85036
Strand -
E-value 1e-27