Japanese | English    

BAC Detail View

DME1-019I02.R
Clone Detail
Accession no AG932953
Direction 3'
Sequence TGTCACAGTCGGGTTATAGGTAAATTGCAGTTTTAAACACCAAAAATGAACGCAAAGGAT
TATAATTCAAAACAGCATTTCCCTACTTTAAAAACGATTTTCGAAATTTAGAATGATATT
TTCAGATTGACAGTGTCTCAATCCACACTGCACGTTTGGCAAAAACATGGATTCAAAGCG
AAAATGTAAAAGTTTTTTTATGGCCACCATACTACTACTATATAATAGATAACGTGTGGG
TATGGTTGGCTAGGAAGGTATACGAGGGTGGTAAACAATATGCCACTCAAAACGAATCGT
TCACCGGAATAAAACTCGATTGGTCTGCGATTACTTTGGATTACCTACAAAAAAATATAT
GATTCCCTTTCCAGACGAATGTGTGAAGTCCATAATTTCCTTTAAAAATATTCTAATTTA
AATATTTAAGTGTTAATCATCCCAATTTCTTTCGAAATGAATCGAACCAACTTAAATTAT
CTTAGGGGGCGTTATCCTGATAACCCAATTTTAATTAACCCATTTATGGATTTTTTTTTT
ACTTAA
Homology
Chromosome 4
From 84733
To 84837
Strand -
E-value 1e-24