Japanese | English    

BAC Detail View

DME1-015B10.F
Clone Detail
Accession no AG930407
Direction 5'
Sequence GAGCTCTGTTACGAAATTTTGGATGGTATTTCTGGTAGTATTTCTAGTAAAGGTAACGAA
TACTGAAACAATCTCGCACTGCCACACTTTTGCAAAATGTTTTGATACGCTCATAAACCG
CCCACAACTGAAGCCGCCAAACTTTTGAAAAATTTTTGATTTTTCTTCGTTTTATTGTTT
TTTTTTTTTTGTTTTCAATTTTTATCGGTATACCAGAACACGGTCGCACCCACATCTGTT
AGGAATGATTTAATTTTGGTCACGCCCAAATGATTATACCAGTTGTTTTGCCAATTTTTT
ATTGATATTCAAAGACATTTTGTCCGCGCCCACTCTGACACCTTAAGCCCGACCAAATCT
TTTCCGCCCACACCTTTGAGCGTTACATTTTTTTCCCCCAATTTACACCGATTTCCTGAA
AAATGTTTTTAAAAATTTCGAGTAACAGCTATCTG
Homology
Chromosome 4
From 74712
To 74736
Strand +
E-value 5e-05