Japanese | English    

BAC Detail View

DME1-008N11.F
Clone Detail
Accession no AG926831
Direction 5'
Sequence GCTCATGCAATGTAAATTTGACAAAATATGCTCTTCATCTTATTATTATATATTATATAT
ATTTTTATTATTTATTATGCGTGTTTACAGCACATAAGTTTATTGGTAACTGAATTCAAA
TTATGTATGCTTGCTGTACGCAGGCAGCGTTAGAATATGCGAGCAAAGAGTGATCGACGA
TCAGTAGCGAAAACACTCAAAAAGGAAGTAACCGTTGCTGGCAGGCAACTTGAGTGTTTG
AGTACACAAGTGAGTAATTGAGTGATTCTTACATACACCGTTGTTCATTATATATATTCA
ACACTCCTTCTCAACGTTGTATGTTTACATATTCACTCAAAACAGTCCCATTAGCTTAAT
ACATTTATTATGCTTAATTCTACTTAAATTCTTTGTTAACACATATCATATATCATATCT
ATCTATCTATAATATCATATCTCTGACATGATGATATTTAATGTCAATGTGTTTGGTTCT
TGCGTGGAACCTAGGATTCTTAACTAAGCATTGCGAACTTTGGTTGCCGCTATAGATCTG
CACATCTCCGAAACCCATTTCGGCAACCAGCTCCCTGAT
Homology
Chromosome 4
From 74388
To 74429
Strand -
E-value 6e-08