Japanese | English    

BAC Detail View

DME1-004O10.R
Clone Detail
Accession no AG924816
Direction 3'
Sequence ATAATAGATTATTAAAAATTGCATTTCCCTACTTTAAAAACGTTTTCGGAAATCTAGAAT
GGCATTTTCAGCACGTTTTTGTTCCAATCCACACTGCACGTTCGGTAAAAACATGGATTC
AAAATGGAAATGTAAAGTGGCCACCATAATCCCCAGACCTTAATATAATAGAAAACGTGT
TACGATGGTTGAGTTTGATGCTCTTGAAAACAAAGGAAGATTAACTCATTATTAATTTCC
TTTAAAACTTTAATATTTAAATGTTAATCAACTAATTTTTTCGAAATGAATCGAAAAAAC
TTTAAACATTTCATTTATAAAATTGTTCAACTTTTGAGCGATAAATTTTCCAAAGCTATC
GCAAATTTTTTGTGCG
Homology
Chromosome 4
From 84755
To 84867
Strand -
E-value 4e-17