Japanese | English    

BAC Detail View

DME1-018O22.F
Clone Detail
Accession no AG932615
Direction 5'
Sequence GAGCTCGTTCGTCTGCCGTTGTCCAGCTGTCCGTCTGATTTGCATCTTTTCAGACGCACA
CTAATGCACAGCAAACACACACACAGCTGGAGCAGCAATTATTGCATTTATGAAATTCAG
CTGCTGCTTCTGCTGCTGCAGCTACTTCACAGATACTCGTCGGCTTTAGTATGTGCCTTT
CGGATTCAGAGCTTTGGACACAGGGTTTTCCTCCGACTTCTTTTTACTGCTTTCATACGC
TTTCTTTGGGTATCACATCTGCAAGTCGATATTGCGACAGCATCAGTCTTATCATTTTCA
GTTAAGGGGTCTAATCATGTCTTAGGGGATACAATTTCTGGACTTTAGCTTTGTACTATC
TTTTTTGATAGATTGAGCATTCAAAGGGTTGAGCTTTAGAATAAAAGTAACAATTATTGC
TTCAGAATAAACCTTATAATCTTATAATAAATTTAATTTTAACAGGATTTTATAAAAATA
CGATTTTATAAGAAATACTAAATGCCCAAAAGGGTATGCATTTGATTCCTGACTTCGATT
CAGGAGACTGTTGTTAAATTTCGGGAATGCGATTCGCATGGGAATGTGCTTCTTC
Homology
Chromosome 3R
From 13018147
To 13018197
Strand +
E-value 2e-20

DME1-018O22.F
Clone Detail
Accession no AG932615
Direction 5'
Sequence GAGCTCGTTCGTCTGCCGTTGTCCAGCTGTCCGTCTGATTTGCATCTTTTCAGACGCACA
CTAATGCACAGCAAACACACACACAGCTGGAGCAGCAATTATTGCATTTATGAAATTCAG
CTGCTGCTTCTGCTGCTGCAGCTACTTCACAGATACTCGTCGGCTTTAGTATGTGCCTTT
CGGATTCAGAGCTTTGGACACAGGGTTTTCCTCCGACTTCTTTTTACTGCTTTCATACGC
TTTCTTTGGGTATCACATCTGCAAGTCGATATTGCGACAGCATCAGTCTTATCATTTTCA
GTTAAGGGGTCTAATCATGTCTTAGGGGATACAATTTCTGGACTTTAGCTTTGTACTATC
TTTTTTGATAGATTGAGCATTCAAAGGGTTGAGCTTTAGAATAAAAGTAACAATTATTGC
TTCAGAATAAACCTTATAATCTTATAATAAATTTAATTTTAACAGGATTTTATAAAAATA
CGATTTTATAAGAAATACTAAATGCCCAAAAGGGTATGCATTTGATTCCTGACTTCGATT
CAGGAGACTGTTGTTAAATTTCGGGAATGCGATTCGCATGGGAATGTGCTTCTTC
Homology
Chromosome 3R
From 13018214
To 13018758
Strand +
E-value 0.0

DME1-018O22.R
Clone Detail
Accession no AG932616
Direction 3'
Sequence CTTGCGATGCGGGCAACTCAAGGCATTCAGCCTGCTTCAAGGACACCACGGTGGTGGCGG
GCGCTTTAAGTGGGGAGGGGGCTTGGAAATGGGTGGCCTGGCCCCAAAAGTTATGCTAAT
TCGGGCTTTCATTAAGTCACAGCACCCATCACAGCCCGTCTTCTTCTTCGGCTGGCCCGA
GTCAAAAGTTTATAGTTGGCAAACATTTGGGCAGCCTTAAGTTTAATAACTTAATGACAC
GAGTCGAGGCTAAAACCAAGTGCAAAGTAGGCTGGTCAGCTGCTAAATTAAGTTCGAAGG
GCACGGAGTTACACTGTTCGAGATAAATAAGTTGCTGACTAAATTCCTTACAGAAAATAT
GAAGTGCTCTTTATTATTTTAATGTTGTTATTTTTTTTCAAACAAAGTTTATTATTCAAC
GTTACGGCTAAAAGAATGCCCATTGAGATGAAGAAAAATGCATTCACTTTCACAAATTGT
AATGGCGTCTTTCTATATGAAACTGAATATCCTTGTTG
Homology
Chromosome 3R
From 13153866
To 13154383
Strand -
E-value 0.0