Japanese | English    

BAC Detail View

DME1-011I08.F
Clone Detail
Accession no AG928360
Direction 5'
Sequence GAGCTCATCTGCCACACACGAAATGTTCAGGAAATACATAATTTCATTATGTTTCTCCCC
GCTGTTCCCTGAAATCGCCTGCAGCACAAACTGTCAACACGGTTGGCATACTTCCCCGCC
CCCCCCACCCACACCAATTTTCCGCCAACTCTCAACACATTTTGGCCTGCCCCACCCACT
TTTCTTAGTCCGGGGGCGTTGGCAGATAACGGTTTACTTTCTTAATCTCCGTACATAATT
TTTGCGACTTCATGTTACGCAATGTATGTATGGCGCATTCTTTCCGCTTCTGCGAAATAA
CATACGATCTTCTTCATTTTAGGTAACTTGGCTTATCTGAAGGCTTTGGCAATTTAGTTA
ATTGGTAAATATGCCTGCTTTCGTTTAATGAAATCTAGCTCAGCCCATATTTATTAGTAT
GAACTACTAACGGTATTATAGTATACAATTACCAACATATATTCAAAATGACTTTTTTTA
TTTTATATATATGATTTTACTACAAGATTCTTTCTATAATTTAAATTATGATTGATTAGA
AAAGCCCTGCTTTACTTATTGTTTTCCCTGCTTGATTTTCACCTTAGTTCTGACTGT
Homology
Chromosome 2R
From 16221460
To 16222054
Strand +
E-value 0.0

DME1-011I08.R
Clone Detail
Accession no AG928361
Direction 3'
Sequence TTTTAAAATGCTACTTTCACGCCAAATTTAATCTGAATGACATTTGGGGGGCGAAACTAG
TGCCAAACAATGAACGAGTGCCAGATTGCGTTTTAAGATGTGACCTAAGCCTGTGGTTAA
GCAAACGGAAAACGGAGTTCAACAATTTCTTTAATATAAGCTTTTCTGGTATTTAAAGTA
CAGCTTTTTAAGAGGACATATCAAAGTCGGCGCATTTCTTCAAACTTTCTTTTGATGGCC
CAAACAACACTTGAGGCATTCTTAGACACTTCAGCAGGCCAAAAGATTAATGGAATTGGC
ATTGAAAAACATCAGAGTGTCGAGCATACTTATGTGGGAGCCGAAATAGAATAGTCACAA
AGAGAAGATGAAACCCAAATTGATAAATATCAAATTAAAAATGCCACAAAAAGCAGAGAT
TATAATACCGAAAGCGGCAGACAACAGGACCGTAAATAAAGTCACATAAACGGCCATAAA
CGACTACTGCTTTTGTTATTATTATTGGTCGACTGAAAAAAAAAA
Homology
Chromosome 2R
From 16328255
To 16328776
Strand -
E-value 0.0